Sequence Updates
S. pombe Sequence Updates Since July 2003
Jul 2003 Chromosome 1 Gap Filled
Added PCR product SPACPJ113 6900 with overlaps of 504 bp with c1856 and 147bp with p4C9
Joined contigs p4C9 and c977
Apr 2004 Chromosome 1 cosmid c6B12:
Single base deletion at c6B12 13981 from tgttctgcAtttttcc to tgttctgctttttcc
(Note: this change was not added to the spread sheet on the ftp site until Jan 18 2006)
May 2004 Chromosome 2 cosmid c646:
Single base transition A->C at c646 from aatggaccAtacccc to aatggaccCtacccc
(Note: This change does not affect sequence coordinates)
May 2006 Chromosome 1 cosmid c21E11:
Single base insertion at c21E11 from gagtgca to gagtgGca (in cyp8) base 4257404 in new chromsome file (note reverse strand sequence reported)
Jan 2007 GeneDB moves from Contigs to Chromosomes
Contigs merged into chromosomes: the 4 sequence gaps represented by 100 Ns
(Note: that the chromosomes previously made available from the ftp site had 1000 Ns in the gaps)
Jun 2008 197 potential sequence discrepancies from the Broad Institute
PENDING 2008-08-26
Generated as part of a technology development project, using Illumina (Solexa) technology the Broad Institute generated >200-fold sequence coverage of the genome of S. pombe strain 972. These data identified 197 potential discrepancies. The discrepancy rate is about 1 in 100,000, which is close to the estimated error rate in published reference sequence. Further information and data here
Jun 2008 GATC in overlap c1450 and c1442 affects SPCC1442.04c
PENDING 2008-08-26
There are 4 bases missing from this sequence AACATCTTCCAAGTTCTCAT GATC CTTTAAAGATTCCTCAAGGT, which will change the C-terminal region slightly. This will be fixed in the next round of corrections
Aug 29 2008 Chromosome 1 cosmid c27D7 misassembly causing duplication of SPAC27D7.09c (SPAC27D7.10c)
PENDING 2008-08-29
An apparent repeat region on chromosome 1 coordinates 4526059..4529095 (cosmid c27D7) is caused by a missassembly and will be removed from the genomic sequence shortly. The CDS feature SPAC27D7.10c within this region is an exact duplication of SPAC27D7.09c and will be merged with this CDS. Pers. comm. Klavs Hansen. Reported 09/01/04
Aug 29 2008 Chromosome 2 cosmid c21D10 affecting SPBC21D10.06c/Map4
PENDING 2008-08-29
Map4 in the reference genome contains an array of 5 repeats. In PMID:168571979 repeats are reported. This number is the correct number of repeats and will be updated via an insertion into the contig sequence shortly S. Pers. comm. Henar Valdivieso Reported 06/15/05
Aug 29 2008 Chromosome 1 cosmid c767 affecting SPAC767.01c/Vps1
PENDING 2007-08-23
At 1999191 in Vps1 TGTGACC[C->G]TACGAC PMID:18088324, also confirmed by Broad sequence; Pers. comm. Isabelle Jourdain Reported 06/15/05
Aug 29 2008 Chromosome 1 cosmid C30 OR c29E6 affecting SPAC29E6.04c/Nnf1
PENDING 2008-08-29
The reference sequence appears to contain an extra 'G' at position 4410193 PMID:17035632, also confirmed by Broad sequence; Pers. comm. Aki Hayashi Reported 05/16/07
