warning in e3188b7c6757274d: occurs_during() not allowed for molecular_function, annotation: SPAC25B8.19c.1 <-> DNA-binding transcription repressor activity, RNA polymerase II-specific
warning in 0d06afc3089ee763: allele_type for new allele "mcm4-DA(amino_acid_insertion)" does not match the existing allele with the same name "mcm4-DA(amino_acid_mutation)" (from session 0d06afc3089ee763)
warning in 8de8896718b55bd8: storing feature_cvterm from PomBase-genotype-582 to normal protein localization to site of mechanical stress [assayed_protein] PomBase:SPBC30B4.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Microscopy"  from session: 8de8896718b55bd8
warning in 27524319ad84c25c: storing feature_cvterm from 27524319ad84c25c-genotype-76 to abnormal colony morphology [has_severity] high - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000229", evidence: "Microscopy"  from session: 27524319ad84c25c
warning in 062ae65578cd43ea: description for new allele "rad26.a14(510-NPLIVC)" does not match the existing allele with the same name "rad26.a14(AATCCCTTAATAGTATGC tandem repeat inserted after nt 1530)" (from session 062ae65578cd43ea)
warning in 062ae65578cd43ea: allele_type for new allele "rad26.a14(amino_acid_insertion)" does not match the existing allele with the same name "rad26.a14(other)" (from session 062ae65578cd43ea)
warning in d4d976e3056b1065: has_input() not allowed for PSI-MOD, annotation: SPAC6F6.15.1 <-> L-cysteine methyl ester
warning in 260925d9ac1a773d: can't find relation cvterm for: has_substrate in these CVs: relationship go/extensions/gorel fypo_extension_relations PSI-MOD_extension_relations external fission_yeast_phenotype
warning in e976a54955ad43a4: description for new allele "cdc27-R39(827-TCGACAATCGATAAGACTGACA)" does not match the existing allele with the same name "cdc27-R39(nt 807-828 duplicated; translated product has aa 1-179 plus 4 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R39(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R39(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R22(782-C)" does not match the existing allele with the same name "cdc27-R22(nt C inserted after 782; translated product has aa 1-164 plus 12 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R22(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R22(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(nt 930-1102 duplicated; translated product has aa 1-271 plus 24 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R5(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R5(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R40(nt 968-1025 duplicated; translated product has aa 1-245 plus 5 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R40(1025-TTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAG)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R40(other)" does not match the existing allele with the same name "cdc27-R40(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R3(nt 813-828 duplicated; translated product has aa 1-179 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R3(827-ATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R3(other)" does not match the existing allele with the same name "cdc27-R3(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R25(nt 694-814 duplicated; translated product has aa 1-175 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R25(814-GTTGTTTGACATTCGATCCTTCCGTCTTCGGAAGACTAACTTATTGTAGCCTCGTGTTTTGAAAAAGGCACCTTCAACTCATTCCCCCCAATTATCTGTTCCCTCAAAGACATCGACAATC)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R25(other)" does not match the existing allele with the same name "cdc27-R25(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in 288cc0705ff9b896: can't find term with ID: PR:000027550
warning in aeb3d0063f6b810: has_input() not allowed for PSI-MOD, annotation: SPCC1795.06.1 <-> L-leucine removal
warning in aeb3d0063f6b810: has_input() not allowed for PSI-MOD, annotation: SPCC1795.06.1 <-> L-leucine removal
warning in aeb3d0063f6b810: has_input() not allowed for PSI-MOD, annotation: SPCC1795.06.1 <-> L-leucine removal
warning in 7bd5662a92fe98d7: description for new allele "cdt1-PIP28delta(Q28A,L31A,and amino acids 32-37,39 deleted)" does not match the existing allele with the same name "cdt1-PIP28delta(32-37,39,Q28A,L31A)" (from session 7bd5662a92fe98d7)
warning in 7bd5662a92fe98d7: allele_type for new allele "cdt1-PIP28delta(other)" does not match the existing allele with the same name "cdt1-PIP28delta(amino_acid_deletion_and_mutation)" (from session 7bd5662a92fe98d7)
warning in 6186ba197a53e798: description for new allele "spt5-(T1A)7(T1A mutations within the CTR)" does not match the existing allele with the same name "spt5-(T1A)7(CTR,T1A)" (from session acd89b47e1b47f21)
warning in cbaaa61496b71364: allele_type for new allele "gar2::ura4+(disruption)" does not match the existing allele with the same name "gar2::ura4+(other)" (from session ab7d71d62a2030e3)
warning in 8a66efe1aac64683: description for new allele "spt5-(CTD)T1A(7)((CTD)T1A(7))" does not match the existing allele with the same name "spt5-(CTD)T1A(7)((CTD)T1E(7))" (from session 8a66efe1aac64683)
warning in 216f4dec12ef6153: description for new allele "ndc80-GFP(GFP-C)" does not match the existing allele with the same name "ndc80-GFP(ndc80 tagged with GFP)" (from session fe7a0f32d4e76d5d)
genotype DUMMY has no alleles
warning in 00f542dd6c29c6f8: allele_type for new allele "atp1-A2313(amino_acid_mutation)" does not match the existing allele with the same name "atp1-A2313(nonsense_mutation)" (from session 1509b9be31a0fb9f)
warning in ff086b28d1132e67: inhibits() not allowed for molecular_function, annotation: SPBC32F12.09.1 <-> cyclin-dependent protein serine/threonine kinase inhibitor activity
warning in 2a8be2bb0239204b: description for new allele "plo1 fusion (Cnp3)(Plo1 centromere tethered)" does not match the existing allele with the same name "plo1 fusion (Cnp3)(Plo1-centromere tethered)" (from session 2a8be2bb0239204b)
warning in 2a8be2bb0239204b: description for new allele "cnp3C-TEV(cnp3C-TEV)" does not match the existing allele with the same name "cnp3C-TEV(protease inactivated)" (from session 7d2c05ef7277f909)
warning in 721bf4355105bfb4: can't find relation cvterm for: has_substrate in these CVs: relationship go/extensions/gorel fypo_extension_relations PSI-MOD_extension_relations external fission_yeast_phenotype
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTD-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(CTR,T1A)" (from session acd89b47e1b47f21)
warning in 8481a1a5bf90b23e: description for new allele "spt5(T1E)7(CTD-T1E)" does not match the existing allele with the same name "spt5(T1E)7(T1E mutations within the CTR)" (from session 8481a1a5bf90b23e)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTR-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(CTR,T1A)" (from session acd89b47e1b47f21)
warning in d2fab1f2b453d796: in extension for d2fab1f2b453d796-genotype-16, can't find feature with identifier: can1 - can't find feature for: can1