warning in 66d1d84a63cd8a3e: description for new allele "rpb1-CTD-S5.S5A(-CTD-S5.S5A(alternating))" does not match the existing allele with the same name "rpb1-CTD-S5.S5A(CTD-S5.S5A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPCC1322.12c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBC20F10.06 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPCC1020.02 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBC800.13 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBC1861.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBP22H7.09c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPAC4F10.12 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBP8B7.12c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBC18E5.03c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPAC25B8.14 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPAC1783.03 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: in annotation extension for PomBase-genotype-5142, can't parse identifier in "assayed_protein(assayed_protein(fta7)"
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBC409.04c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 3e04cbe2621b6a70: storing feature_cvterm from PomBase-genotype-5142 (mhf2delta) to decreased protein localization to centromere [assayed_protein] PomBase:SPBC11C11.03 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "microscopy evidence"  from session: 3e04cbe2621b6a70
warning in 95ec493fb8fa90cf: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in f7e61f1bbab2a27b: description for new allele "myo2-ST(chimera+myp2-aa1923-2104)" does not match the existing allele with the same name "myo2-ST(myo2-myp2(1923-2104))" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: description for new allele "myo2-LT(chimera + myp2-aa1622-2104)" does not match the existing allele with the same name "myo2-LT(myo2-myp2(1622-2104))" (from session f7e61f1bbab2a27b)
warning in 2a8be2bb0239204b: description for new allele "plo1-TEVAA341(tev-site@AA341)" does not match the existing allele with the same name "plo1-TEVAA341(plo1(1-341)-(ENLYFQGAS)-plo1(342-405)-(ENLYFQGAS)-plo1(406-683))" (from session 2a8be2bb0239204b)
warning in c757e60bdb79c5cb: in annotation extension for c757e60bdb79c5cb-genotype-1, can't parse identifier in "assayed_using(SPNCRNA.574)"
warning in 92cda7cb8c6c7a8c: can't load annotation, GO:1990521 is an obsolete term
warning in 5f8aff66a56b4439: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 5f8aff66a56b4439: description for new allele "rpb1-CTD-S7A((CTD)S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A(1-29))" (from session 95ec493fb8fa90cf)
warning in 7c7509b7ad78573d: in annotation extension for SPCC825.04c.1, can't parse identifier in "has_input(hta3)"
warning in db9b5a7b5f36c25c: description for new allele "rec8(TEV)(rec8-AA341::TEV)" does not match the existing allele with the same name "rec8(TEV)(rec8(1-361)-(ENLYFQGAS)-rec8(362-561))" (from session db9b5a7b5f36c25c)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-S2A((CTD)S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-P3.P3A((CTD)P3A(alternating))" does not match the existing allele with the same name "rpb1-CTD-P3.P3A(CTD-P3.P3A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-P6.P6A((CTD)P6A(alternating))" does not match the existing allele with the same name "rpb1-CTD-P6.P6A(CTD-P6.P6A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-S7A((CTD)S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A(1-29))" (from session 95ec493fb8fa90cf)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-S5.S5A((CTD)S5A(alternating))" does not match the existing allele with the same name "rpb1-CTD-S5.S5A(CTD-S5.S5A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-Y1F((CTD)Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session 66d1d84a63cd8a3e)
warning in 44703db6ac552c71: can't load annotation, GO:1902375 is an obsolete term
warning in 44703db6ac552c71: can't load annotation, GO:0072684 is an obsolete term
warning in a6782fab5fd233d0: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 216f4dec12ef6153: description for new allele "ndc80-GFP(ndc80-GFP)" does not match the existing allele with the same name "ndc80-GFP(ndc80 tagged with GFP)" (from session fe7a0f32d4e76d5d)
warning in 85219fa3fd50b9ee: can't find term with ID: GO:1903478
warning in 85219fa3fd50b9ee: can't find term with ID: GO:1903478
warning in 2267c01b48c1c47c: description for new allele "rqh1-h2(Q790*)" does not match the existing allele with the same name "rqh1-h2(ntC28520T)"
warning in 2267c01b48c1c47c: allele_type for new allele "rqh1-h2(nonsense_mutation)" does not match the existing allele with the same name "rqh1-h2(amino_acid_mutation)"
warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A(1-29))" (from session 95ec493fb8fa90cf)
warning in ab08277b7b3bc9c4: description for new allele "cdc13-RLuc(cdc13-RLuc)" does not match the existing allele with the same name "cdc13-RLuc(hypomorph)" (from session ab08277b7b3bc9c4)
warning in ab08277b7b3bc9c4: allele_type for new allele "cdc13-RLuc(fusion_or_chimera)" does not match the existing allele with the same name "cdc13-RLuc(other)" (from session ab08277b7b3bc9c4)
warning in 0d638c12aef4db07: description for new allele "cgs2-2(1366-T)" does not match the existing allele with the same name "cgs2-2(T1366-T)" (from session 219e86a87274fe5f)
warning in acd89b47e1b47f21: description for new allele "rpb1-CTD-T4A(5-29)(CTD-T4A(5-29))" does not match the existing allele with the same name "rpb1-CTD-T4A(5-29)(CTD-T4A(5,29))" (from session a93df4140a4b1e4c)
warning in 37237b530ab38bc9: description for new allele "cdc23-tstd(Ub-DHFRts-cdc23-C239Y)" does not match the existing allele with the same name "cdc23-tstd(fusion;C239Y,AA424::TEV,degron)" (from session 4488533ca5f8fdc3)
warning in 37237b530ab38bc9: description for new allele "mcm4-tstd(cdc21-M68-degron(DHFR))" does not match the existing allele with the same name "mcm4-tstd(Ub-DHFRts-mcm4)" (from session 7097a362b55929af)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R39(A827-TCGACAATCGATAAGACTGACA)" does not match the existing allele with the same name "cdc27-R39(A837-TCGACAATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R39(A827-TCGACAATCGATAAGACTGACA)" does not match the existing allele with the same name "cdc27-R39(A837-TCGACAATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R3(nt 813-828 duplicated; translated product has aa 1-179 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R3(A827-ATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R3(other)" does not match the existing allele with the same name "cdc27-R3(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in af39cc71da933c2d: description for new allele "rpb1-CTD-Y1F((CTD)Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session 66d1d84a63cd8a3e)
warning in af39cc71da933c2d: description for new allele "rpb1-CTD-S2A((CTD)S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 66d1d84a63cd8a3e)
warning in af39cc71da933c2d: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 6e9c92a7382e9127: description for new allele "cdc18-46(E521A,D524A)" does not match the existing allele with the same name "cdc18-46(E521A,Q334A)"
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4671 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBP4G3.02 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4671 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBC8E4.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "transcript expression level evidence", condition: "FYECO:0000005,FYECO:0000137"  from session: ff1e67fe7824549f
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4671 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBC1703.13c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in ff1e67fe7824549f: storing feature_cvterm from 66d1d84a63cd8a3e-genotype-14 (ssu72-C13S) to decreased RNA level [assayed_transcript] PomBase:SPBC1703.13c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTD-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 6186ba197a53e798)
warning in 8481a1a5bf90b23e: description for new allele "spt5(T1E)7(CTD-T1E)" does not match the existing allele with the same name "spt5(T1E)7(T1E mutations within the CTR)" (from session 8481a1a5bf90b23e)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTR-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 6186ba197a53e798)
warning in 977c41e138dc2e0d: in annotation extension for 977c41e138dc2e0d-genotype-2, can't parse identifier in "has_penetrance(high)"
warning in 977c41e138dc2e0d: in annotation extension for 977c41e138dc2e0d-genotype-2, can't parse identifier in "has_penetrance(high)"
warning in 977c41e138dc2e0d: in annotation extension for 977c41e138dc2e0d-genotype-3, can't parse identifier in "has_penetrance(low)"
warning in 59bf3609c95bb937: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 59bf3609c95bb937: description for new allele "rpb1-CTD-S7A((CTD)S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A(1-29))" (from session 95ec493fb8fa90cf)
warning in 59bf3609c95bb937: allele_type for new allele "nc-pho1-dual-PAS-mut(amino_acid_mutation)" does not match the existing allele with the same name "nc-pho1-dual-PAS-mut(nucleotide_mutation)" (from session ab5171b90f5cef1d)
warning in 59bf3609c95bb937: description for new allele "nc-pho1-DSR(TTAAA-89-CGCGC,TTAAA-96-GCCCG,TTAAA-103-CGCGC,T399C,A401G,C404T,T413C,A415G,A416G,C418T)" does not match the existing allele with the same name "nc-pho1-DSR(DSR domain mutated)" (from session 59bf3609c95bb937)
warning in fd7d19b1aed14f7c: in annotation extension for fd7d19b1aed14f7c-genotype-1, can't parse identifier in "assayed_using(SPAC17G6.02c.2)"
warning in fd7d19b1aed14f7c: in annotation extension for PomBase-genotype-3351, can't parse identifier in "assayed_using(SPAC17G6.02c.2)"
warning in fd7d19b1aed14f7c: in annotation extension for fd7d19b1aed14f7c-genotype-3, can't parse identifier in "assayed_using(SPAC17G6.02c.2)"
warning in a4ab4922ffecbd92: can't load annotation, GO:1903478 is an obsolete term
warning in 1edc814df6ff1176: can't find term with ID: GO:0035103
warning in bad7d44a253000ca: description for new allele "rpb1-CTD-S7A(5-29)(rpb1-CTD-S7A(5-29))" does not match the existing allele with the same name "rpb1-CTD-S7A(5-29)(CTD-S7A(5-29))" (from session a93df4140a4b1e4c)
warning in 089bad866432ef28: allele_type for new allele "ras1+(amino_acid_mutation)" does not match the existing allele with the same name "ras1+(wild_type)" (from session e040917969e21e31)
warning in 0b0990bc7e9460b7: description for new allele "rng2-Ns(301-1489)" does not match the existing allele with the same name "rng2-Ns(1-399)" (from session d1ca5d873c81c5fa)
warning in 0b0990bc7e9460b7: description for new allele "rng2-Ns(301-1489)" does not match the existing allele with the same name "rng2-Ns(1-399)" (from session d1ca5d873c81c5fa)
genotype DUMMY has no alleles
warning in 4927cddae28a3185: allele_type for new allele "sid2-as4(amino_acid_mutation)" does not match the existing allele with the same name "sid2-as4(amino_acid_insertion_and_mutation)" (from session acd1a2d2ddcf29cc)
warning in e3188b7c6757274d: description for new allele "loz1+(a Loz1-GFP fusion protein that is expressed from a derivative of the pgk1 promoter containing a deletion in the TATA box.)" does not match the existing allele with the same name "loz1+(wild type)" (from session bf037075feb20f28)
warning in 33497d588756c658: description for new allele "rpb1-CTD-S2A((CTD)S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 66d1d84a63cd8a3e)
warning in 774b7f1a9f489629: description for new allele "cdc18-46(E521A,D524A)" does not match the existing allele with the same name "cdc18-46(E521A,Q334A)" (from session 6e9c92a7382e9127)